16S rRNA gene Sequencing
16S rRNA gene Sequencing
Technology Introduction
In the process from DNA samples to final data, each step such as sample test, PCR, purification, library preparation, and sequencing will affect the quality and quantity of data, while the data quality will directly affect the subsequent information analysis results. In order to keep the accuracy and reliability of sequencing data, quality control (QC) is performed at each step of the procedure.
|
Types |
Amplified Region |
Fragment Length |
16S rRNA gene Sequencing Primers |
Sequences (5’- 3’) |
|
Bacterial 16S |
V4 |
300 bp |
515F |
GTGCCAGCMGCCGCGGTAA |
|
806R |
GGACTACHVGGGTWTCTAAT |
|||
|
V3-V4 |
470 bp |
341F |
CCTAYGGGRBGCASCAG |
|
|
806R |
GGACTACNNGGGTATCTAAT |
|||
|
V4-V5 |
450 bp |
515F |
GTGCCAGCMGCCGCGGTAA |
|
|
907R |
CCGTCAATTCCTTTGAGTTT |
|||
|
V5-V7 (for endophytic) |
435 bp |
799F |
AACMGGATTAGATACCCKG |
|
|
1193R |
ACGTCATCCCCACCTTCC |
|||
|
Archaeal 16S |
V4-V5 |
400-500 bp |
Arch519F |
CAGCCGCCGCGGTAA |
|
Arch915R |
GTGCTCCCCCGCCAATTCCT |
Sample Requirements of 16S rRNA gene Sequencing
|
Sample Type |
Amount |
Volume |
Concentration |
Purity |
|
Total DNA |
≥ 200 ng |
≥ 20 μL |
≥ 10 ng/μL |
A260/280 = 1.8-2.0 |
Next-Generation Omics Solutions:
Proteomics & Metabolomics
Ready to get started? Submit your inquiry or contact us at support-global@metwarebio.com.