16S rRNA is a component of the 30S small subunit of the ribosome in prokaryotic cells, containing 9 hypervariable regions (V1-V9).Since 16S rDNA amplicon sequencing typically selects one or several hypervariable regions of interest, the universal primer used during PCR amplification is designed from the conservative regions that encompass the hypervariable regions of interest, which will allow for the identification of microorganisms from the hypervariable regions through subsequent analysis (Caporaso et al., 2011; Youssef et al., 2009; Hess et al., 2011).With the continuous development of high-throughput sequencing platforms, the PE250 sequencing strategy can be realized through the upgraded Illumina sequencing platform.
In the process from DNA samples to final data, each step such as sample test, PCR, purification, library preparation, and sequencing will affect the quality and quantity of data, while the data quality will directly affect the subsequent information analysis results. In order to keep the accuracy and reliability of sequencing data, quality control (QC) is performed at each step of the procedure.
Biomarker screening
Functional research
Mechanistic research
Research on leaf-associated microbial interactions
Research on root-associated microbial interactions
Types | Amplified Region | Fragment Length | Primers | Sequences (5’- 3’) |
Bacterial 16S | V4 | 300 bp | 515F | GTGCCAGCMGCCGCGGTAA |
806R | GGACTACHVGGGTWTCTAAT | |||
V3-V4 | 470 bp | 341F | CCTAYGGGRBGCASCAG | |
806R | GGACTACNNGGGTATCTAAT | |||
V4-V5 | 450 bp | 515F | GTGCCAGCMGCCGCGGTAA | |
907R | CCGTCAATTCCTTTGAGTTT | |||
V5-V7 (for endophytic) | 435 bp | 799F | AACMGGATTAGATACCCKG | |
1193R | ACGTCATCCCCACCTTCC | |||
Archaeal 16S | V4-V5 | 400-500 bp | Arch519F | CAGCCGCCGCGGTAA |
Arch915R | GTGCTCCCCCGCCAATTCCT |
Sample Type | Amount | Volume | Concentration | Purity |
Total DNA | ≥ 200 ng | ≥ 20 μL | ≥ 10 ng/μL | A260/280 = 1.8-2.0 |
Please submit a detailed description of your project. We will provide you with a customized project plan metabolomics services to meet your research requests. You can also send emails directly to support-global@metwarebio.com for inquiries.