+1(781)975-1541
support-global@metwarebio.com

16S rRNA gene Sequencing

16S rRNA gene sequencing, abbreviated as 16S sequencing, is a method for sequencing a specific target region. 16S sequencing can identify the categories and abundance of bacteria in a specific environment.

Technology Introduction

16S rRNA is a component of the 30S small subunit of the ribosome in prokaryotic cells, containing 9 hypervariable regions (V1-V9).Since 16S rDNA amplicon sequencing typically selects one or several hypervariable regions of interest, the universal primer used during PCR amplification is designed from the conservative regions that encompass the hypervariable regions of interest, which will allow for the identification of microorganisms from the hypervariable regions through subsequent analysis (Caporaso et al., 2011; Youssef et al., 2009; Hess et al., 2011).With the continuous development of high-throughput sequencing platforms, the PE250 sequencing strategy can be realized through the upgraded Illumina sequencing platform.

In the process from DNA samples to final data, each step such as sample test, PCR, purification, library preparation, and sequencing will affect the quality and quantity of data, while the data quality will directly affect the subsequent information analysis results. In order to keep the accuracy and reliability of sequencing data, quality control (QC) is performed at each step of the procedure.

Application Direction

In the medical field
In the plant field
Get A Quote
Primers applied to Amplicon Sequencing (5 pairs)

Types

Amplified Region

Fragment Length

Primers

Sequences (5’- 3’)

Bacterial 16S

V4

300 bp

515F

GTGCCAGCMGCCGCGGTAA

806R

GGACTACHVGGGTWTCTAAT

V3-V4

470 bp

341F

CCTAYGGGRBGCASCAG

806R

GGACTACNNGGGTATCTAAT

V4-V5

450 bp

515F

GTGCCAGCMGCCGCGGTAA

907R

CCGTCAATTCCTTTGAGTTT

V5-V7 (for endophytic)

435 bp

799F

AACMGGATTAGATACCCKG

1193R

ACGTCATCCCCACCTTCC

Archaeal 16S

V4-V5

400-500 bp

Arch519F

CAGCCGCCGCGGTAA

Arch915R

GTGCTCCCCCGCCAATTCCT

Get A Quote

Sample Requirements

Sample Type

Amount

Volume

Concentration

Purity

Total DNA

≥ 200 ng

≥ 20 μL

≥ 10 ng/μL

A260/280 = 1.8-2.0

 

WHAT'S NEXT IN OMICS: THE METABOLOME
Please submit a detailed description of your project. We will provide you with a customized project plan metabolomics services to meet your research requests. You can also send emails directly to support-global@metwarebio.com for inquiries.
Name can't be empty
Email error!
Message can't be empty
CONTACT FOR DEMO
Related Metware Metabolite Profiling
+1(781)975-1541
LET'S STAY IN TOUCH
submit
Copyright © Metware Biotechnology Inc. All Rights Reserved.
support-global@metwarebio.com +1(781)975-1541
8A Henshaw Street, Woburn, MA 01801
Contact Us Now
Name can't be empty
Email error!
Message can't be empty